Journal: bioRxiv

Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia

doi: 10.1101/2021.02.02.429407

Figure Lengend Snippet: (a) Immunoblot analysis of HIF1A and ARNT proteins in the indicated MIA PaCa-2 HIF1A and ARNT knockout cell lines treated with the prolyl-hydroxylase (PHD)-inhibitor FG-4592 (100 μM, 72 hrs) as shown. Vinculin was used as a loading control. FG-4592 is used to stabilize HIFs and confirm pathway disruption. (b) Relative mRNA levels of HIF1A-target lactate dehydrogenase A (LDHA) mRNA expression in the indicated MIA PaCa-2 knockout cells treated with FG-4592 (100 μM for 72 hrs) compared to untreated cells. (c, d) Representative images ( c ) and quantification ( d ) of TMR-dextran (red) uptake in the indicated MIA PaCa-2 knockout cell lines under normoxia (21% O) or hypoxia (0.5% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. In d , data are presented relative to values obtained for normoxic control cells. (e) Immunoblot analysis of HIF1A in MIA PaCa-2 cells expressing a constitutively stable HIF1A isoform (HA-HIF1A P402/P564A) cDNA. Vinculin was used as a loading control. (f, g) Representative images ( f ) and quantification ( g ) of TMR-dextran (red) uptake in MIA PaCa-2 cells transduced with vector control or HA-HIF1A P402/P564A cDNA under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). In g , data are presented relative to normoxia cells transduced with a control vector. (h) Quantification of macropinocytic uptake from sections of xenograft tumors derived from MIA PaCa-2 cells transduced with a control sgRNA or sgRNAs targeting HIF1A or ARNT showing tumor macropinocytic index in hypoxic tumor areas (CK8+/Pimo+, red) and non-hypoxic tumor areas (CK8+/Pimo-, grey). Data is presented relative to non-hypoxic areas in tumors arising from cells transduced with a control sgRNA. (i) Representative images from sections of xenograft tumors derived from MIA PaCa-2 cells expressing HA-HIF1A P402/P564A cDNA showing macropinosomes labeled with TMR-dextran (red), tumor cells immunostained with anti-CK8 (green), and pimonidazole detected with anti-pimonidazole (purple). Nuclei are labeled with DAPI (blue). Dashed lines indicate high (purple) and low (white) areas of pimonidazole staining. Scale bar = 50 μm. (j) Quantification of macropinocytic uptake in (i) showing tumor macropinocytic index in hypoxic tumor areas (CK8+/Pimo+, red) and non-hypoxic tumor areas (CK8+/Pimo-, grey). Data is presented relative to non-hypoxic areas in tumors derived from cells transduced with a control vector. b, d, g, Bars represent mean ± s.e.m.; h, j , At least 500 ( c, d, g ) or 300 ( h, j ) cells were quantified in each biological replicate ( n = 3). Statistical significance was determined by two-tailed unpaired t -test.

Article Snippet: Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC.

Techniques: Western Blot, Knock-Out, Control, Disruption, Expressing, Labeling, Transduction, Plasmid Preparation, Derivative Assay, Staining, Two Tailed Test

Journal: bioRxiv

Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia

doi: 10.1101/2021.02.02.429407

Figure Lengend Snippet: (a) Immunoblot analysis of HIF1A and ARNT in the indicated sgRNA-transduced PANC-1 cells treated with FG-4592 as shown. Vinculin was used as a loading control. (b, c) Representative images ( b ) and quantification ( c ) of TMR-dextran (red) uptake in control or sgHIF1A- or sgARNT-transduced PANC-1 cells under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. In c , data are presented relative to values obtained for control normoxic cells. (d) Relative mRNA levels of the HIF1A-target lactate dehydrogenase A (LDHA) in the indicated MIA PaCa-2 cell lines expressing a control vector or HA-HIF1A P402/P564A cDNA and treated with the prolyl-hydroxylase (PHD)-inhibitor FG-4592 (100 μM, 72 hrs) as shown. (e, f) Representative images ( e ) and quantification ( f ) of TMR-dextran (red) uptake in PANC-1 cells expressing a control vector or HA-HIF1A P402/P564A cDNA under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. In f , data are presented relative to values obtained for control normoxic cells. (g) Immunoblot analysis of HIF1A in MIA PaCa-2 and BxPC-3 cells treated with 0, 100, and 500 μM of DMOG under normoxia (21% O 2 ). Vinculin was used as a loading control. (h) Representative images of TMR-dextran (red) uptake in MIA PaCa-2 cells in the absence or presence of DMOG (500 μM) under normoxia (21% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. (i) Quantification of macropinocytic uptake in MIA PaCa-2, PANC-1 and BxPC-3 cells treated in the absence or presence of DMOG (500 μM) under normoxia (21% O 2 ). Data are presented relative to values obtained for untreated cells. (j) Representative images of TMR-dextran (red) uptake from sections of xenograft tumors arising from MIA PaCa-2 cells transduced with sgRNAs targeting HIF1A or ARNT with tumor cells immunostained with anti-CK8 (green), and pimonidazole detected with anti-pimonidazole (purple). Nuclei are labeled with DAPI (blue). c, d, f, i, Bars represent mean ± s.e.m. At least 500 ( c, f, i ) cells were quantified in each biological replicate ( n = 3). Statistical significance was determined by two-tailed unpaired t -test.

Article Snippet: Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC.

Techniques: Western Blot, Control, Labeling, Expressing, Plasmid Preparation, Transduction, Two Tailed Test

Journal: bioRxiv

Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia

doi: 10.1101/2021.02.02.429407

Figure Lengend Snippet: (a) Representative images of CA9 expression (red) from sections of MIA PaCa-2 xenograft tumor tissue with tumor cells immunostained with anti-CK8 (green), and pimonidazole detected with anti-pimonidazole (purple). Nuclei are labeled with DAPI (blue). (b) Immunofluorescence of CA9 relative to CK8 in sections of xenograft tumors arising from MIA PaCa-2 parental cells. Data are presented relative to values obtained for CK8+/pimo-areas. (c) Immunoblot analysis of CA9 and HIF1A in indicated cell lines expressing a control vector or HA-tagged HIF1A P402A/P564A cDNA. Vinculin was used as a loading control. (d) Immunoblot analysis of CA9 in the indicated cell lines transduced with a control sgRNA or an sgRNA targeting CA9. Vinculin was used as a loading control. (e, f) Representative images ( e ) and quantification ( f ) of TMR-dextran (red) uptake in control or sgCA9-transduced PANC-1 cells under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. In f , data are presented relative to values obtained for control cells under normoxia. (g) Immunoblot analysis of CA9 in MIA PaCa-2 and PANC-1 cells transduced with CA9 cDNA or a control vector. Vinculin was used as a loading control. (h) Representative images of TMR-dextran (red) uptake in control or CA9 overexpressing PANC-1 cells under normoxia (21% O 2 ) with macropinosomes labeled with TMR-dextran (red). Nuclei are labeled with DAPI (blue). (i) Quantification of TMR-dextran uptake in control or CA9 overexpressing PANC-1 cells under normoxia (21% O 2 ) and hypoxia (0.5% O 2 ). Data are presented relative to values obtained for control cells. (j) Quantification of TMR-dextran uptake in the indicated cell lines transfected with a control (-) or an SLC4A7 siRNA under normoxia (21% O 2 ) and hypoxia (0.5% O 2 ). Data are presented relative to values obtained for control normoxic cells. (k) Quantification of TMR-dextran uptake in MIA PaCa-2 cells treated with the PKA inhibitor H89 (15 μM) as shown under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). Data are presented relative to values obtained for control normoxic cells. b, f, i, j, k, Bars represent mean ± s.e.m. At least 300 ( b ) and 500 ( f, g, j, k, l ) cells were quantified in each biological replicate ( n = 3). Statistical significance was determined by two-tailed unpaired t -test.

Article Snippet: Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC.

Techniques: Expressing, Labeling, Immunofluorescence, Western Blot, Control, Plasmid Preparation, Transduction, Transfection, Two Tailed Test